The Oscars of the game world? What are some of the TGA award-winning games in recent years?

2021-12-20 22:25:12

Read on

Inventory of the top ten hot events in the game circle in 2021
Game circle Play coffee edg tga Life reopens the simulator Two-person walk League of Legends Black Myth: Goku Three Kingdoms Killing Battle of the Twin Cities
02-13
Valentine's Day for esports people opens the way, with a small perk!
Esports Tencent Esports Small v tga
02-13
Which game companies will be the protagonists of large acquisitions?
Microsoft Sony Activision Blizzard Warner Bros. interactive entertainment Beach volleyball Final Fantasy XI6 Japan Mizoku Sega Samei tga
02-26
A YouTube broadcaster finds the lost TGA trophy for the Azure Mountains team and returns it
Azure Mountains tga ryan
02-27
After three and a half years, the "Azure" development team finally received the 2018 TGA Trophy
tga azure ryan
02-27
Azure's TGA trophy was lost for 4 years and finally appeared on eBay
azure tga IT House ebay isk
02-28
The largest ever "soul" series, "Eldon's Ring of Law" released a commemorative interview
Eldon's Ring of Law Only Wolf: Shadow passed away twice Dark Souls fromsoftware George R.R. Martin Miyazaki
03-01
Azure's TGA trophy returned to the developers after four years of loss
tga azure ryan ebay
03-01
TGA Jackpots get soft! The games made by the former Soviet Union are regarded as gods by Chinese players
tga Bliss Disco dice Almost impossible
03-02
Hidetaka Miyazaki once again ascended to the altar! Eldon's Ring of Law sold more than 270,000 in japan in its first week
Hidetaka Miyazaki Eldon's Ring of Law Sophie's Alchemy Workshop 2 Japan Only Wolf: Shadow passed away twice Cyberpunk 2077
03-04
"Two-Man Trip" producer "Grumpy Brother" finally received 3 TGA trophies
tga Two-person walk
03-05
There are interesting coincidences between the characters in Horizon 2 and the characters in Only Wolves
Only Wolf: Shadow passed away twice Quetaro Horizon 2 dalal horizon Eloy
03-07
Borrowing from the popularity of Eldon's Ring of Laws games, let's talk about one of the key to video games' appeal - confrontation
Eldon's Ring of Law Role playing game Only Wolf: Shadow passed away twice Dark Souls
03-08
The faded people who "cheated" on La ni after being abandoned by the "ring guard woman"
La ni Melina Only Wolf: Shadow passed away twice Eternal truth Fire prevention woman Hidetaka Miyazaki
03-10
Out of the loop completely! Why is the new soul game "Eldon's Law Ring" so popular?
Eldon's Ring of Law Hidetaka Miyazaki Only Wolf: Shadow passed away twice steam
03-10
The explosive "Eldon's Ring of Law", what magic did Hidetaka Miyazaki use?
Hidetaka Miyazaki Eldon's Ring of Law Only Wolf: Shadow passed away twice Demon Souls Bloodborne curse
03-13
Today is the 3rd anniversary of the release of TGA's 2019 game of the year, Only Wolf: Shadow Gone Twice
Only Wolf: Shadow passed away twice tga
03-22
Soul + Heavenly Curse, the third anniversary of "Only Wolf: Shadow Death Twice" continues to exert force
Only Wolf: Shadow passed away twice Action games playstation
03-22
After three and a half years of loss, the "Azure" TGA trophy was returned to its original owner
tga azure
03-26
April Fool's Day news? Officially confirmed the cancellation of the 2022 E3 Game Show and the Summer Game Show instead!
e3 Game Show Nintendo tga ign
04-01
AGTCAGTGATATGGAACCTA
genome tga Human genes Human Genome Project chromosome
04-01
The little successes and big joys in The Eldon Ring
Eldon's Ring of Law Only Wolf: Shadow passed away twice thicket
04-10
God of War 4 Fourth Anniversary: TGA 2018 Best of the Year Original PS4 Exclusive
God of War 4 tga Mars Kratos God of War 3
04-20
TGA Game of the Year! "Two People In Line" to make a film and television drama: Dwayne Johnson is expected to participate
Michien Hiromori Two-person walk tga Cody
04-21
Touch Music Night Talk: Strike iron really decompress
Touch Strike iron boss Only Wolf: Shadow passed away twice Eldon's Ring of Law Genichiro
04-22
NetEase Games accused King of Glory of plagiarizing Dwayne Johnson or starring in the live-action movie "Two-Man Trip" | Daily B
Glory to Kings Dwayne Johnson Two-person walk NetEase Games Dyson Ball Program
04-22
The top ten mainstream action games that are worth experiencing at the moment are the favorite gods of enthusiast players
Action games Watchdog: Legion Only Wolf: Shadow passed away twice Monster Hunter: Rise Assassin's Creed: Temple of Valor Marvel Guardians of the Galaxy
04-25
Touch Night Talk: Life always has to give up something
Touch valkyrie Eldon's Ring of Law Only Wolf: Shadow passed away twice
04-26
Let's talk seriously about whether there will be a Bloodborne Curse 2 丨 Bonfire
Bloodborne Curse 2 Bloodborne curse Sony Only Wolf: Shadow passed away twice Gravity Whimsical World Hidetaka Miyazaki
04-27
Finished Twilight of the Gods? Santa Monica is hiring for the next AAA!
Santa monica Twilight of the gods God of War: Twilight of the gods Santa Monica Studio Mars
05-01
Tomorrow's Ark Samsung Assist Zilan Paradox Simulation Raiders Nostalgic for the Deceleration God of War in the Era of The Wasteland
Zilan Ark of tomorrow Moonlight Night auxiliary Mars
05-02
"Eat Chicken" How long have you not seen the "God of War List"? These 5 gods of war have 1 common feature!
Mars Brother Tian Eat chicken Peace elite photon
05-02
Tomorrow's Ark Third Anniversary Self-Selected Five Stars: These few who have no cooking power do not touch their hands and are also the fate of the warehouse
Ark of tomorrow Full picture book Mars The King of Fighters Javi
05-02
Game Morning Post: "Overwatch Returns" B test has a plug-in?
Overwatch returns Plug Only Wolf: Shadow passed away twice Black Desert
05-02
Can the original god miscellaneous talk all four-star character teaming up? The Six-Star God of War is going to be exhausted
Mars Diona Bennett Row autumn Xiangling
05-02
Yao Yang invites sting against the God of War Chicken Camp! Andy Lu wanted to invite out of the professional team, and Yao Yang was afraid to see id
Andy Lu Shine sting Mars gk
05-03
Is the original god Xiangling worth cultivating?
Xiangling greenhorn Mars fishing Thunder Fairy
05-03
How to change the soup without changing the medicine, and the plug-in does not need to be upgraded to use it directly? What exactly did Overwatch 2 test?
Sojén Plug Overwatch 2 Dr. X Overwatch Blizzard
05-03
Source: Sony will not announce a "God of War 5" trailer at State of Play
God of War 5 Sony Horizon 2: Western Forbidden Territory playstation Mars
05-03
Only a few days after the beta version of Overwatch 2 has already appeared a familiar plug-in
Overwatch 2 Plug Robot_Game Blizzard Overwatch
05-03
Ark of Tomorrow: This is the strongest six stars in the third anniversary, do you understand the gold content of resisting daddy lumens
Ark of tomorrow Daddy Mars
05-03
Destroy the ball into a bomb ball! The beta version of Overwatch 2 is now seriously buggy
Destroy the ball Overwatch 2 Overwatch
05-04
God of War Undead The new Nissan GT-R may still be in development
Nissan gt-r Mars Nissan
05-04
Blizzard plans to improve the Overwatch 2-assisted gameplay experience and optimize the UI
Blizzard Overwatch 2 auxiliary Gaming experience Overwatch
05-04
"Eat melon" disaster-prone "Overwatch" and embarrassing OWL
Overwatch Blizzard Overwatch 2 Owl League
05-04
Proto-God: How should Bennett, the 6-star god of war, be raised? 3 tricks to teach you to use his abilities to the extreme!
Bennett Mars Attack Health
05-04
Fantasy Journey to the West: The Treasure Pavilion Sword Fight will queue for 40 minutes, and Haowen is beaten by the opponent of the 8 Duan Spirit to escape
Treasure Court Fantastic Journey to the West Howe Sword Society Spirit ornaments Mars
05-05
Fantasy Journey to the West: Serve the God of War Haodu's eyes! Level 129 with 80 billion experience, willing to spend 500,000 R to buy
Fantastic Journey to the West Mars Fixation Spirit ornaments
05-05
Hugely popular! Over 45% of the players in the Steam Edition of God of War 4 have completed the game!
God of War 4 Mars
05-05
Overwatch 2 Korea officially released a cohort questionnaire
Overwatch 2 Overwatch
05-05
Since when did the mainstream offline multiplayer games become non-mainstream
Single-player game Board games Two-person walk
05-05
Movies and games: Fight each other
Two-person walk talent
05-06
The five most popular new game titles
Only Wolf: Shadow passed away twice Eldon's Ring of Law Shadow Samurai 3 An open world Final Fantasy Shadow Samurai
05-06
The TGA Summer Games Festival will take place on June 10
tga summer game fest Canada
05-06
Overwatch is less than one-tenth of Activision Blizzard's total 2021 revenue
Activision Blizzard Overwatch Call of Duty Candy Powder Legend Candy Crush Legend
05-06
Dream Journey to the West: Treasure Pavilion 0 God of War Expedition, 300 billion experience of the first person Fufeng settled in the three major platforms
Fantastic Journey to the West Treasure Court Mars Fufeng Ancient Artifacts Howe
05-08
Overwatch 2 heat plummeted 90%! Plug-ins have become the focus of hot discussion among players, is it really curable?
Overwatch Plug Overwatch 2 Blizzard Eternal disaster
05-08
The popularity of the first week of "Overwatch 2" declined, and millions of viewers were lost, what went wrong?
Overwatch 2 Blizzard Overwatch Warcraft
05-08
"Eat chicken" high-level plus too little? Teach you to stack "4 buffs", God of War 1 plus 66 points!
Dan Mars Eat chicken Eat chicken fresh things quick report
05-10
Can you see the difference? Overwatch 2 map compared to previous generations
Overwatch 2 Overwatch Blizzard
05-11
Excalibur 3 announces the latest demo on July 29
Xenoblade Excalibur 3 Xenoblade Excalibur switch
05-11
Nintendo's latest financial report shows that the switch's cumulative global sales are 107.65 million units
Nintendo switch Mario Kart 8 Deluxe Edition
05-11
Nintendo earnings: Switch sold 17.65 million units
switch Nintendo Pokémon
05-11
Watch League Professional Team Match Exploit Loophole Ruled Invalid Replay
The light of order Blizzard Overwatch Esports
05-11
【Topic】Which game are you most looking forward to this year?
Nintendo switch God of War Gods Twilight Sony
05-11
OWL Review: Why did the Sharpshooters lose to the defenders of the Winston system in the Iron Fist system?
sharpshooter Defenders iron fist Winston final muse Overwatch PUBG
05-11
Happy Spring Festival! 7 games on Switch for Chinese New Year!
switch
01-23
"Warcraft 3" and those derivative RPG gods, the national service will be closed, and the legend will not end
legend Warcraft National service Blizzard
01-25
Behind Blizzard's departure is the 14 years of love that countless players have been let down
NetEase Warcraft Uk National service Nostalgic clothes Blizzard
01-25
The last day of Blizzard players
Warcraft Blizzard
01-28
After 25 years of cultivation, Blizzard left only "Diablo: Immortal" in China
NetEase Warcraft National service Blizzard
02-01
NetEase opened the Blizzard game refund channel, more than 700,000 people applied! The archiving puzzle is unsolved
NetEase Blizzard
02-05
Hogwarts Legacy Global Unlock Time Announced: Deluxe Edition 3 Days Advance
switch
02-07
A million people lined up for a refund: Blizzard Games continued to cease after the game was suspended
NetEase Warcraft Blizzard Activision Blizzard
02-11
Meddlesome? Activision Blizzard pays $35 million fine, Microsoft acquisition may change?
Microsoft Warcraft Blizzard Activision Blizzard
02-14
More fun than Motion? Why is "Friends Gathering" worth the blood book of thousands of people!
Financing measures for micro, small and medium-sized enterprises Nintendo switch
02-17
Sold 120 million units worldwide! The Nintendo Switch is close to the console king PS2
Sony Nintendo switch Nintendo Switch
02-18
Game information: The Legend of Zelda price cut, Nintendo receives Microsoft subpoena, Switch and new games
Microsoft Nintendo switch Zelda
02-21
Handsome! 10.1 New T24 Pro Set Exposed! New Dragon Art appearance, etc
Blizzard
03-09
What other classics of the NDS era deserve to be resurrected? 丨Bonfire
switch
03-12
Xia Yike: Blizzard is like an ex-boyfriend who has been with you for many years, and after you are forced to break up, you still can't bear to say bad things
Blizzard
03-17
"Overwatch 2" "Empress Xiaomei" skin display Chinese player: embarrassed
skin Overwatch
03-29
Super Mario Bros.: The most successful game adaptation of all time, without one!
Financing measures for micro, small and medium-sized enterprises Nintendo Mario
04-08
Shigeru Miyamoto on "Super Mario Bros. Movie": I don't want to be compared to Walt Disney
Nintendo
04-12
The game streamer "Super Kid" received an official gift from Nintendo
anchor Nintendo
04-14
Breaking the record for game adaptations, Super Mario swept North America
Nintendo
04-19
Douban 8.0 box office ranked first in the world, Ye Qing back
Nintendo
04-24
They resurrected the national bank "The Legend of Zelda", which was aborted 19 years ago
Nintendo
04-30
Download "Kingdom Tears" must see, don't let "any loss" become "you lose"! 【What to play this week】
switch Sequel
05-02
Lao Ren covered his face when he saw it! The Zelda Black History Game is actually resurrected!
Nintendo Zelda The Legend of Zelda
05-05
Does Link have a dad and sister? The Legend of Zelda series also has some knowledge that you don't know
Financing measures for micro, small and medium-sized enterprises Nintendo Link Zelda The Legend of Zelda
05-09
After Blizzard NetEase broke up: players wandered, anchors were frustrated, and it was difficult to find a takeover
NetEase Warcraft National service Blizzard Activision Blizzard
05-15
"Zelda: Tears of the Kingdom" turns on the ray tracing effect on PC The graphics are gorgeous
Financing measures for micro, small and medium-sized enterprises switch
05-16
A work of God on top of a divine work, but still not for everyone. Kingdom Tears review.
Financing measures for micro, small and medium-sized enterprises switch
05-17
Diablo 4 released a new trailer, as well as a preload time announced
Blizzard Diablo Diablo 4
05-26
"Diablo 4" quiz show, Blizzard's "barrage" was debunked! Experts race to attract firepower
Blizzard Diablo Diablo 4
05-30
How many people wept bitterly in childhood by this game?
Nintendo
06-02
"Super Mario Bros. Movie" ChatGPT-level script, but the audience still bought it
Financing measures for micro, small and medium-sized enterprises Nintendo
06-02
2023 Nintendo Face to Head Face will be summarized
IT House Nintendo Nintendo Facing Association
06-22
All six god costumes officially announced by Blizzard have dropped, and Chinese players have obtained four! The most expensive piece is 280,000 RMB
Blizzard
07-01
"Let's All Together 1-2 Switch" Review: 100 Dogfight! GAT Wedding Team Building New Skills
Financing measures for micro, small and medium-sized enterprises Nintendo switch ns
07-04
Diablo 4's ad complaint was dismissed, and Blizzard said adults were not responsible for fear
Blizzard Diablo
07-07
"Diablo 4" unveiled the first season "Plague Demon Season", which started on July 21
Blizzard
07-07
Here it comes! Nintendo next-gen console name leaked! Codenamed NX 2!
Nintendo switch
07-07
Game information: Microsoft is determined to win and settle with Sony Nintendo for mergers and acquisitions!
Microsoft Sony Call of Duty Nintendo Activision Blizzard Nintendo Switch
07-19
Overwatch 2 had "rave reviews" on its first day on Steam, with about 20,000 reviews
IT House Overwatch Overwatch 2
08-11
Blizzard's Overwatch 2 Steam Bad Reviews exceeded 100,000, accounting for 63% Chinese Simplified
IT House Blizzard Overwatch Overwatch 2
08-15
If you are an official of Overwatch 2 and Three Kingdoms, how do you reverse the bad reviews?
Overwatch Three Kingdoms Killing
09-06
Switch2 New News: Lower expectations, performance is not as powerful as expected!
Nintendo switch ns Pokémon Nintendo Switch
09-13
It is reported that the new "Mario" game is the first open-world 3D game in the series
IT House Nintendo
09-27
Marvel's Spider-Man 2: Battle for two, explore a full optimization
Two-person walk Spider-Man spider Double
10-24
Epic Plus 17 Double Trip is less than 30! Red Dead Redemption 2 starts at 55
Two-person walk Double
12-15
Steam Winter Promotion Double Trip PriceSteam Winter Promotion Big Cousin 2 Price List
Two-person walk Double
12-19
Traveling in two, EA failed to connect to the server/Unable to connect to the EA server/EA Invite Friends could not pop up
Two-person walk server serve Double
12-21
Players guess that the next Hi +1 of E Bao is "It Takes Two": the elements can be corresponding
Two-person walk Double
12-25
[laughs] [laughs] Steam Winter Promotion, as a result, Black Soul III is still 134, and Bandai really intends to use this thing as a cyber heirloom. I took a look at a few other games and saw the price drops
Two-person walk Game number devise screen Double
12-26
[covers face] [laughs and cries] The wallet is really unbearable, the annual Steam Winter Sale has started and will last until 2 am on January 5th. The number of games on sale
Two-person walk Game number purse Double Team building
12-26
The loading interface of the two-person card cannot be entered/the startup is not responding/the card is starting the solution
Two-person walk Double
01-04
1. Monster Hunter World: If you have friends, hunting online with friends is much happier than playing single-player by yourself, and it just so happens that the number of online people in Monster Hunter World is back to its peak, yes
Two-person walk famine Game Double world
01-07
How to solve the problem of failure to connect to the EA server in pairs?
Two-person walk server serve Double
04-16
The new work of the developer of "It Takes Two" was announced this year
Two-person walk Developers exploitation Double
04-16
There are no competing products on the same track, and "It Takes Two" sold 20 million copies! The main creator of the new content is still in Tibet
Two-person walk Double
10-17
The new work of the studio "It Takes Two" is a new IP
Two-person walk Job Double
10-18