laitimes

AGTCAGTGATATGGAACCTA

AGTCAGTGATATGGAACCTA

The first truly complete sequence of the human genome was finally born. It has no gaps "from start to finish", contains information about every chromosome, and achieves unprecedented precision.

It is the result of more than 20 years of unremitting efforts by scientists since the release of the working sketch of the human genome in 2001. Scientists believe this is another milestone breakthrough in genomic research. The team has recently published six papers in the journal Science to describe the new genome in detail.

Stand on the shoulders of giants

The Human Genome Project (HGP) was launched in 1990 with the goal of determining the order of DNA bases in our human chromosomes and unveiling the blueprint for human genes. In 2001, 21 years after the Genome Project was launched, HGP and Serella Genome Company published a working sketch of the human genome. At this point, we have officially entered the era of genomic research.

But at the time, the scientists' task was not over. The original sketch of the human genome sequence doesn't actually cover the full genome, it just contains what we usually call autosectin, or can be simply understood as "more active" regions. Autochromatin makes up about 92 percent of the human genome, and most genes are in it, and they are key to making gene products like RNA and proteins.

The reason behind this mainly comes from the limitations of technology. Because the human genome is so long, scientists can't read all the information at once. They had to "cut" these genes into smaller pieces, analyze each piece of information separately, and finally integrate it into a complete map. However, under limited technical conditions, these fragments can only be divided into very fragments, so it is inevitable that a lot of information will be missed, and errors are inevitable.

By 2013, after more than a decade of effort, the Genome Reference Alliance (GRC) had released an updated human reference genome, GRCh38. The so-called reference genome is a common means of research, it is not from a single individual, usually assembled by scientists to assemble a database of nucleic acid sequences, as a genetic representation of an ideal individual of the species.

The SEQUENCE OF GRCh38 COMES FROM MULTIPLE ANONYMOUS VOLUNTEERS. It's already one of the most accurate and complete vertebrate genomes, but still not a "verbatim" complete genome.

From telomeres to telomeres

In 2019, biologists Karen Miga and Adam Phillippy organized an international team of scientists called the Telomere-to-Telomere (T2T) Consortium. The team's goal is to overcome those gaps in the human genome, from telomeres to telomeres, that is, to uncover the sequence of chromosomes from beginning to end.

Prior to that, Miga had been involved in research demonstrating the potential of a technique called nanoporous sequencing in creating complete human genome sequences. It can obtain ultra-long reads containing hundreds of thousands of base pairs, and the new technology of such ultra-long reads has become the key to future breakthroughs.

In June 2020, Miga led the team to complete a major breakthrough, combining nanopore sequencing and other sequencing techniques, and using optical map integration and other means, for the first time "from beginning to end" to confirm the complete sequence of the human X chromosome. This achievement also marks that creating intact human chromosomes accurate to the base has become a reality. (See "First Complete Sequence of the Human X Chromosome.") )

A year later, in June 2021, the team had actually completed sequencing the CHM13 genome and uploaded the paper in a preprint. At the time, CHM13 already contained complete information about almost all sequences with extreme precision, with the addition of nearly 200 million new sequences of base pairs, including 99 genes that could code for proteins, and nearly 2,000 candidate genes for further study. It also corrects thousands of structural errors in the current reference sequence. (See "The Complete Human Genome is Near.") )

One obvious omission in CHM13 is the Y chromosome. Because the study cleverly selected intact mole cells containing two identical X chromosomes, this made the sequence easier to assemble and therefore lost the opportunity to sequence the Y chromosome. But scientists are already confident that their methods also have the ability to accurately sequence the Y chromosome.

AGTCAGTGATATGGAACCTA

Since the introduction of HGP in 1990, the proportion of human genome sequences has been published. | Image source: NHGRI

Now, the team has published the entire T2T genome sequence, which represents the completed CHM13 genome, plus the recently completed T2T Y chromosome. The researchers believe that the new T2T reference genome will be a powerful complement to the human reference genome GRCh38.

Human Pan-Genome Reference

The sequencing of the human genome is somehow complete, but it's more like a phased victory, with more exciting research to come.

The T2T Alliance has now begun a collaboration with the Human Pan-Genome Reference Alliance. They plan to create a new human pan-genome reference based on the complete genome sequences of 350 individuals.

Pan-genomics captures the diversity of human populations, and it can also help us more accurately understand the entire genome, such as finding a large number of genetic variants in different populations, understanding their role in disease, and exploring genetic diversity within and between populations.

In the next stage, scientists will begin to think about the human genome reference, not a single genome sequence. This is a profound transformation, and it can even be said to be a harbinger of a new era. We will eventually capture human diversity in an unbiased way.

#创作团队:

Written by: Takeko

Typography: Wenwen

#参考来源:

https://news.ucsc.edu/2022/03/t2t-genome.html

https://www.rockefeller.edu/news/32087-the-human-genome-is-at-long-last-complete/

For the first time, the complete sequence of the human X chromosome is obtained

The complete human genome is just around the corner

#图片来源:

Cover image: MIKI Yoshihito from Sapporo City, Hokkaido., JAPAN

Image: Peter Artymiuk/lookandlearn .com

Read on