During the Spring Festival, people preparing to go home for the Chinese New Year are faced with the epidemic prevention requirements of the 48-hour negative report of nucleic acid at the destination. There are long queues at the doors of each nucleic acid testing point, and people shivering in the cold wind can't help but think: Why can't the report be issued any faster? Why can't you get the report in half an hour like a regular blood test?
Nucleic acid testing is really already sprinting at full speed, and it's still trying to improve, getting faster and faster.
01
What exactly did the nucleic acid test test?
First, nucleic acid is not a new term. It is the genetic material in living organisms, and there are two main categories: DNA and RNA. Nucleic acids also preserve genetic information in a way that is "written" from beginning to end in several different molecules, and only four letters in total. If it is DNA, write it in A, T, C, G, write it in 2 rows; if it is RNA, write it in A, U, C, G, write it in 1 row; as if it were some kind of quaternary code.
Image source: wiki
PS: If you have a college entrance exam candidate who has chosen biology at home, you can ask him to tell you what nitrogen-containing bases A, T, C, and G represent, which are not explained in detail because they do not affect the understanding.
These biological codes are not made up casually, and many things can be learned by analyzing their order. For example, some passwords are different from ID cards, and the criminal police use this to determine that the murderer is Zhang San, an extralegal fanatic, rather than Li Si, who carries the pot. Some passwords have similarities between relatives and can be used to determine that the child is his own rather than being sent with a phone bill.
There is also a part of the code that is consistent in the same species, which is used to ensure that dragons give birth to dragons, phoenixes, and people, and most people who are born are still two eyes and two legs, and a mouth under the nose. By detecting such codes, one can push back some things — for example, if a certain sequence is caught, the owner of the nucleic acid sequence must be a human, and no matter how much he claims to be a celestial being, it is not easy to make a green snake under the heavenly immortals, he is a human.
The same is true of the new crown virus, as long as the presence of a specific nucleic acid sequence is detected, it is the new crown virus, not other microorganisms or nucleic acids in human cells. Nucleic acid testing is to find a way to catch this specific "identity password".
02
Nanny-level nucleic acid testing
Explanation of technical principles
Although nucleic acids are "macromolecules", their length units of measurement are still in the nanometer range. It is certainly impossible for people to see what is written on it one by one, and it is difficult for the instrument to react to individual molecules. Therefore, in order to catch evidence of the existence of virus identity codes, nucleic acid testing uses a special technique called fluorescence quantitative RT-PCR. First inactivate the collected sample to avoid the virus from waiting for the opportunity, and then use the following steps to force it to confess:
Extraction of nucleic acids
The target of nucleic acid testing is only nucleic acid, the virus itself uses to hold nucleic acid convenient pocket protein shell do not want, everyone is collected by the little sister of the collection point to poke down the snot bubble food residue and so on.
In order to accurately catch out the nucleic acid, there are several methods that can be used. The more commonly used methods are the "one-step method" and the "magnetic bead method".
The easy, fast and economical method is a one-step method: mix the nucleic acid releaser and sample in a PCR tube, let it stand at room temperature for 10 minutes, add a nucleic acid releaser to let the virus crack, and then go up to the centrifuge column for a flurry, let the protein and other unwanted things separate from the nucleic acid, and then fish out the nucleic acid in the upper sol for detection. Nucleic acids suitable for fluorescent PCR detection can be obtained, and the tedious traditional method of multiple centrifugation or heating can be changed into a simple and convenient step operation, which takes a very short time and greatly improves the detection efficiency. However, the disadvantage is that the rate of missed detection is high.
Image source: imgflip.com
There is also a very clever method called the magnetic bead method: throw a point into the solution that can stick with the nucleic acid to kiss my small beads, and when they hold the nucleic acid tightly, use the magnetic force to suck the small beads and fix them, and other unwanted things are washed away. Then find a way to forcibly dismantle the CP to let go of the small ball (usually change the characteristics of the solution, such as PH value, etc.), so that you can get a pure nucleic acid.
Nucleic acid amplification and detection
After the nucleic acids are caught, it is time to see if there is a unique "code" of the nucleic acid of the new crown virus. After all, there are probably some nucleic acids brought by other microorganisms or the human body's own cells in the sample, and if they are good citizens who do not do bad things, they cannot be wronged and reported to the false police.
The way of examination is a bit like a code, some special primers and probes are added to the reagent, the primers shout "Heavenly King Gaidi Tiger", at this time who promised a sentence "Pagoda Town River Demon" who is the new crown virus. Those who don't squeak or answer "I'm two hundred and five" are other innocent nucleic acids. Once the correct answer is heard, the probe throws a fluorescent signal indicating that the bad guy has been found.
"Heavenly King Gaidi Tiger" is a human secret language, and to match the secret code with the viral nucleic acid, you must find a "language" that can be understood by the opposite side.
Where to find it, DNA cannabis flowers everyone has seen, right? Oh, two chains twisted together, in the middle of which are some colorful, colorful things. The important point here is that the small colored horizontal lines in the DNA diagram are not randomly drawn. As mentioned earlier, there are four small horizontal lines representing bases, and the abbreviations are A, T, C, G. And they are paired, the opposite of A must be T, and the opposite of C must be G.
This is the "language" that nucleic acids use to record information, and as long as you know what one of the chains "writes", the other can be matched. So the work becomes simple:
Primer: CCCTGTGGGTTTTACACTTAA
Virus: GGGACACCCAAAATGTGAATT
Probe: That's it!!!
Unfortunately, after a single virus nucleic acid gave the secret code, the signal emitted was too weak. Instrument: Loud! I can't hear you! Where is the fluorescence signal? I didn't see it.
Well, one fluorescent dot doesn't work, thousands of them keep appearing, and they can always catch it. Through polymerase chain reaction, people can force the DNA being detected to make exactly the same copy continuously, 1 into 2, 2 into 4. After repeatedly repeating the code, the probe will confirm the virus again and again and release a fluorescent signal, an exponential increase that is detected by the instrument.
Some people may find a small problem here: the new crown virus is an RNA virus, RNA has only one strand, and this detection mechanism is not aimed at DNA? Don't worry, reverse transcription converts single-stranded viral RNA into double-stranded cDNA before amplification begins, and then analyzes it as usual.
As for why RNA is not directly copied, it is because the RNA single strand is unstable, lack of correction function when copying, and it is easy to make mistakes. Similar to if you copy the "Heavenly King Gaidi Tiger" into the "Heavenly King Gai Gecko", it will be difficult to do next.
03
So can nucleic acid testing be faster?
Through the explanation of the principle, we can see that nucleic acid testing has a set of processes that must be completed step by step, and each step is time-consuming. In particular, the step of amplifying the number of polymerase chain reactions cannot be paused once the machine is turned on. If there is a new batch of samples that need to be tested, it cannot be added in the middle of the way, and can only be opened in a new pot. It's like a rice cooker working halfway through and can't add rice halfway through.
However, in order to meet the heavy demand for nucleic acid testing, the relevant personnel are still using a variety of means to try to make nucleic acid testing faster and faster.
Increase the supply of testing equipment
If a device is too late to do, then "another one" sounds like a matter of course, but nucleic acid testing is not a matter of buying a few instruments and moving them to the site to start work. It needs to rely on laboratories that can guarantee safe operation, and has specific requirements in the treatment of medical waste, air disinfection, etc.
Therefore, the air membrane laboratory that can rise from the ground "out of thin air" within two or three days has become a savior on the front line of the fight against the epidemic. The "Falcon" air membrane laboratory invested in the first half of last year can detect more than 30,000 samples per group per day so that everyone can get the nucleic acid test report in time.
Falcon Air Film Laboratory
Source: Guangzhou Daily
Reduce process time
Optimizing the process of fluorescence RT-PCR has also made nucleic acid testing faster and faster. For example, some nucleic acid releasers do not need to use centrifugation to separate nucleic acids after being added, but can directly enter the next step of amplification.
The non-stop doubling of nucleic acids in a PCR amplification instrument usually takes 95-100 minutes, that is, in order to produce enough copies to be detected by the device. If the sensitivity of the device increases, then it can do fewer rounds of amplification, which will naturally shorten the time.
There is also a way of thinking that the amplification link needs to be repeatedly heated and cooled due to the different temperature requirements of the reactants, so that the thermal conduction structure is improved, so that each heating and cooling becomes faster and shortens the inspection time. In last year's China Innovation and Entrepreneurship Competition, the fastest COVID-19 nucleic acid testing instrument could produce test results within 30 minutes.
Trend of patent applications for nucleic acid testing in China
(In order to increase nucleic acid detection capabilities, R&D personnel are constantly pursuing more efficient technologies)
Source: 21st Century Economic Channel
Take the initiative and do nucleic acid testing on the air
The upcoming 2022 Beijing Winter Olympics will use a self-developed bioaerosol new coronavirus nucleic acid monitoring system that can detect viruses suspended in the air.
The appearance of this set of equipment does not seem to be much different from ordinary testing instruments, but in fact, the steps from sample collection to the test laboratory (including the inactivation treatment, nucleic acid extraction, and amplification described earlier) are all automated and integrated, and the test results are obtained in 45 minutes. And the sensitivity of the instrument reaches 20 copies/ml, which is more than 10 times more sensitive than conventional equipment (200-500 copies/ml). A total of 348 specimens were collected and tested during the test match, and the success rate of detection was 100%.
I hope that after the Winter Olympics show their skills, this system can land in crowded places such as hospitals, stations, and airports in the future, and find the virus in time to help prevent and control the epidemic. Maybe people don't have to line up to do testing
COVID-19 will always pass, but it won't be the last time humanity will battl a massively spreading virus. In the face of new pathogenic microorganisms in the future, these innovative technologies will help human beings better maintain personal health and social order.
bibliography
[1].Li Gang, Ma Wenli, Biochemistry[D]. Peking University Medical Press, 2013
Yu Hanzhong, Niu Lulu, et al., Analysis of inter-room quality evaluation results of different nucleic acid extraction methods and nucleic acid detection reagents for novel coronavirus[J]. Journal of Clinical Laboratory February 2021, 39(2)
[3]. General Office of the National Health Commission, Technical Guidelines for Laboratory Testing of Novel Coronavirus Pneumonia (Fourth Edition), 2020
[4]. Rossi, Liane & Costa, Natalia & Silva, Fernanda & Wojcieszak, R.. (2014). ChemInform Abstract: Magnetic Nanomaterials in Catalysis: Advanced Catalysts for Magnetic Separation and Beyond. Green Chemistry. 16. 2906-2933. 10.1039/c4gc00164h.
[5]. Results within 30 minutes, the fastest new crown nucleic acid detection instrument in China debuted in the entrepreneurship competition, Shanghai Municipal Science and Technology Commission, 2021-09-09, http://stcsm.sh.gov.cn/xwzx/mtjj/20210909/aed248c31ac24a6792d6e2557fe327bd.html
Institute of Process Engineering, Chinese Academy of Sciences, a self-service nucleic acid detection all-in-one machine and microfluidic chip[P]. Chinese Patent, CN214088513U, 2021-08-31
Edits: 91
Acknowledgements: Laboratory Technician Zhang Mengzhe, Department of Clinical Laboratory, Shanghai Putuo District Central Hospital, M.D., M.D
— END —
The reproduced content represents the views of the author only
Does not represent the position of the Institute of Physics, Chinese Academy of Sciences
Source: Shanghai Science and Technology Museum
EDIT: Hidden Idiot