There is no trouble in the eighth day of the first month
Edit丨No worries about the eighth day of the first month
Hemerocallis is a traditional flower in China with a wide range of uses and both ornamental and edible value.
Plant leaves are the main organs of plant photosynthesis, and their growth and development are mainly determined by gene programming and environmental regulation.
Cytochrome P450, or CYPs, has a maximum absorbance at 450 nm and is one of the largest and most diverse superfamilies of enzymes. CYP90B1, also known as DWF4. GhCYP90B1 is a cotton-steroid C22α-hydroxylase gene.
CYPs are widely present in living organisms, and their main functions are metabolism and detoxification and participation in the synthesis of plant secondary metabolites.
The diversity of substrates and functions is characteristic of CYPs and is thought to be the result of evolutionary adaptation in different organisms, driven by different metabolic or environmental needs.
Materials and methods of the experiment
Main reagents: RNA extraction kit, reverse transcription kit, agarose gel recovery kit, PCR kit, Escherichia coli as TOP10 competent cells, cloning vector as pMDTM18-T, BM2000DNAMarker.
The collected daylily leaf samples were ground in liquid nitrogen, and the total RNA was extracted to detect the purity and concentration of RNA.
cDNA第一链合成:RNA2μL、AccuRTReactionMix(4X)2μL、ddH2O4μL,42°C2min,再依次加入AccuRTReactionStopper(5x)2μL、5×All-In-OneRTMasterMix4μL、ddH2O6μL。
The total reaction volume is 20 μL, 25 °C for 10 min, 42 °C for 50 min, and 85 °C for 5 min. The cDNA obtained after reverse transcription is stored in a -20°C freezer for later use.
ACCORDING TO THE TRANSCRIPTOME ASSEMBLY ANNOTATION RESULTS OF DAYLILY, THE PCR PRIMERS FOR HFCYP90B1 GENE WERE DESIGNED AS FOLLOWS: F:ATGCTATCTGAACAGTTTAG;R:TCAGAGTTCAGCTGATATTG.
The target fragment of the candidate gene was amplified using the above cDNA as a template, and the amplification procedure was as follows: 98°C for 3 min, 98 °C for 10 s, 56 °C for 30 s, 72 °C for 90 s, 35 cycles, 72 °C for 5 min, and stored at 4 °C.
Amplification system 50 μL: 2 μL of cDNA template, 25 μL of PremixTaq, 1 μL of upstream and 1 μL of upstream and downstream primers, and the rest was supplemented with ddH2O. Using the DNA gel recovery kit, the gel can be recovered by selecting the appropriate length and brightness of the above product bands.
The recovered product was linked to the cloning vector pMDTM18-T, transformed into Escherichia coli TOP10 competent cells, coated on LB solid medium with ampicin, and incubated in a constant temperature incubator at 37°C for 12 h.
The nucleotide sequences were translated into protein sequences on the ExPASy online website, and the basic physicochemical properties of the protein sequences were predicted using the ProtParam online software.
The affinity/hydrophobicity, subcellular localization, signal peptide and transmembrane structure of the protein were mainly predictively analyzed by protscale, WOLFPSORT, SignalP4.1 and TMHMMServerv.2.0 websites.
The phosphorylation sites were predicted using the NetPhos3.1 online website, while the secondary and tertiary structures of HfCYP90B1 protein were predicted by SOPMA and SWISS-MODEL, respectively.
The NJ method, i.e., the adjacency method, was used using MEGA-X software, and the bootstrap value was repeated 1000 times to construct a phylogenetic phylogenetic tree.
The expression of HfCYP90B1 was analyzed by real-time quantitative PCR instrument, 3 biological replicates, 3 technical replicates, and the ACT commonly used in plants was selected by internal reference genes.
PCR reaction system: ChamQSYBRColorqPCR MasterMix 16.5 μL, cDNA template 2 μL, ForwardPrimer 0.8 μL, ReversePrimer 0.8 μL, ddH2O 14 μL.
Amplification program: 95 °C for 5 min, 95 °C for 5 s, 50 °C for 30 s, 72 °C for 40 cycles, store at 4 °C. 2-△△CT was used to calculate the expression level of HfCYP90B1 gene in large and small leaf areas.
Analysis of experimental results
Plant CYPs can participate in catalyzing many primary and secondary metabolic reactions, and play an important role in biosynthesis in plants.
CYPs are widely found in living organisms, and their main functions are metabolism and detoxification and participation in the synthesis of plant secondary metabolites.
The diversity of substrates and functions is characteristic of CYPs and is thought to be the result of evolutionary adaptation in different organisms, driven by different metabolic or environmental needs.
The electrophoresis results showed that there was one specific band at 750~1000bp, and the specific band consistent with the expected product length was obtained, which met the requirements of the target gene.
The amplification product was recovered, the cloning vector was ligated, and the ligation product was transformed into competent cell E. coli TOP10, the ligated E. coli was plate-coated, and a single colony was picked and colony PCR identification was carried out, and the bands were correctly sent to Bioworker for sequencing verification.
The sequencing results showed that the length of the product was 838 bp, which was completely consistent with the transcriptome assembly sequence, and the gene was named HfCYP90B1.
The physicochemical properties of the protein encoded by HfCYP90B1 were analyzed by the proteomics analysis platform ExPASy, and the results showed that the HfCYP90B1 gene contained 143 amino acids with a molecular formula of C738H1162N200O198S8.
If the molecular mass is 16.26105kD, the total number of atoms is 2306, the aliphatic index is 43.10, the residue negative charge number Asp+Glu is 13, the residue positive charge number Arg+Lys is 17, and the theoretical electric point pI is 9.12, then it is a basic protein.
If the protein instability index II is 43.10, it is an unstable protein. If the average coefficient of hydrophilicity is -0.026, it is a hydrophilic protein. Based on this, it is speculated that the protein is a hydrophilic, unstable basic protein.
The conserved domains of HfCYP90B1 protein were analyzed by Conserveddomains database, and the protein had one specific site Cypx and three non-specific sites CYP90-like, PLN02500 and p450, which belonged to the p450, cytochrome-p450 and Cypx superfamilies.
The results of TMHMMServerv.2.0 prediction of transmembrane domain showed that the entire sequence of the protein was outside the membrane and there was no transmembrane domain, so it did not belong to the transmembrane protein.
The signal peptide was predicted by the SignalP4.1Server online website, and the results showed that the protein did not contain a signal peptide site, so it was a non-secreted protein.
THE RESULTS OF PREDICTING SUBCELLULAR LOCALIZATION FROM WOLFPSORT ONLINE WEBSITE SHOWED THAT THE COEFFICIENT LOCATED IN THE CYTOPLASM WAS 8, THE COEFFICIENT LOCATED IN CHLOROPLAST WAS 2, THE COEFFICIENT LOCATED IN THE NUCLEUS, MITOCHONDRIA, AND PEROXISOMES WAS 1.
The phosphorylation sites were predicted by NetPhos3.1Server, and it was found that there were 15 protein phosphorylation sites in HfCYP90B1 with > 0.5 values, including 10 serine sites, 3 threonine sites and 2 tyrosine sites, respectively.
A total of 135 amino acids were encoded in the amino acid sequence of HfCYP90B1 of Hemerocarpus, of which the content of random coil was up to 47.55%, while the contents of α-helix, extended chain and β-fold were 30.07%, 16.78% and 5.59%, respectively.
The three-dimensional structure of HfCYP90B1 protein was predicted by homology modeling, and HfCYP90B1 was used as a template for 6a18.1.A protein, and the amino acid residue range for establishing the model was 1~139, the sequence consistency was 51.82%, and the sequence similarity was 46%.
The phylogenetic tree constructed by using the HfCYP90B1 gene sequence showed that HfCYP90B1 had homology with other plant species genes, and HfCYP90B1 and pineapple were clustered into the same branch with an homology of 74%.
The relative expression levels of HfCYP90B1 gene in different leaf areas of Hemerocallis K cultivar were compared, and the results showed that the relative expression levels of HfCYP90B1 gene in three Hemerocallis cultivars with different leaf areas were different.
It had the highest relative expression level in K1 line, the lowest relative expression level in K3 line, about 0.179 times that of K1 line, and about 0.33 times that of K1 line in K2 line.
The relative expression level of HfCYP90B1 gene in Hemerois daylily was consistent with the change trend of leaf area, i.e., K1> K3>K2.
The expression level of HfCYP90B1 gene showed an up-regulated expression trend in wide leaves. Therefore, it can be speculated that the HfCYP90B1 gene may be involved in the regulation of leaf growth of daylilies.
Discussion of experimental results
Studies have shown that CYP450s can interact with a variety of substrates, participate in a variety of secondary metabolic reactions in the process of plant growth and development, and have important regulatory functions for plant life network systems.
BRs have a regulatory effect on important agronomic traits such as flowering time, seed yield and stress resistance of plants, and are also essential for plant growth and development, and actively participate in many physiological processes, enhancing plant stress resistance under adversity.
Without the action of auxin, gibberellin and ethylene, it can promote the excessive increase of petiole elongation and upward curvature of leaves.
In addition to gibberellin, cytokinin, auxin, ethylene, and abscisic acid, brassinosterol is considered to be the sixth largest group of plant endogenous hormones.
CYP90B1 is C-22 hydroxylase, so it is also a key rate-limiting enzyme in the BRs biosynthesis pathway, and its catalytic reaction is a key step in the synthesis of BRs, and has an important regulatory role in the BRs biosynthesis pathway.
Overexpression CYP90B1 can effectively regulate the biosynthesis of BRs. The DWF4 gene was able to increase the yield of maize and Arabidopsis thaliana. Under high temperature stress, the gene expression of Arabidopsis thaliana CYP90B1 was up-regulated, and the content of BRs increased.
In European oilseed rape, the Arabidopsis BRs biosynthesis gene AtDWF4 was expressed, and BRs were found to improve tolerance tolerating abiotic and biotic stresses and plant productivity.
The above results can prove that CYP90B1 genes can promote plant growth, increase crop yield, and improve plant stress resistance by regulating the biosynthesis of endogenous BRs.
Studies have shown that CYP90B1 is involved in regulating the growth and development activities of plants such as maize and Arabidopsis, and plays an important role in the stress response of plants such as Arabidopsis thaliana and European rape.
Previous studies found that compared with the wild type, the physiological resistance index and vigor of CYP90B1 transgenic plants under low temperature, salt and other stress conditions were significantly increased, and CYP90B1 could improve the resistance of plants to drought and salt stresses, thereby increasing plant yield.
In this study, based on the transcriptome data of Hemerocallis in the early stage of the research group, the CYP90B1 gene of the CYP family of Hemerocallis was successfully cloned as the starting point, with a total length of 838 bp, and the protein structure prediction and functional analysis were carried out.
According to the results of homologous sequence alignment, the protein sequence similarity between HfCYP90B1 and pineapple homologous gene was 74%, and the sequence similarity was very high, and the functions of the two may be similar.
There are relatively few studies on the function of the CYP gene family of Hemphylla chinensis, an important ornamental plant in China, and its yield and quality are affected by a variety of biotic and abiotic factors.
In the early stage, the CYP family genes of Hemerocallis were identified, classified and named through transcriptome data screening, and their physicochemical characteristics were analyzed by bioinformatics methods.
CYP family genes play a key regulatory role in plant leaf development, and it can be inferred that HfCYP90B1 gene is involved in regulating leaf growth of daylily.
Therefore, in-depth bioinformatics research on this gene is of great significance for further study of its function. In summary, this experiment will provide a scientific basis for the genetic improvement of the leaf shape of Hemerophylla daylily.