Detection of parasites in food of animal origin - Trebudchiasis

Clonorchis sinensis is an important zoonotic parasite that parasitizes people, dogs, cats, pigs, and some other wild animals in the liver bile ducts and gallbladder, causing liver enlargement and other lesions. It can cause clonorchiasis in animals, which humans are often infected by eating uncooked freshwater fish or shrimp containing Cysticerces cerevis. Clonorchidoniasis is one of the most serious foodborne parasitic diseases in China.

1 Etiological features

Mycodystis is a hermaphrodite. Its life history is complex, and according to the developmental order, it can be divided into eight stages: adult worms, insect eggs, hairy worms, cytocys, thunderclaps, tail cysts, cysticers and larvae. Adults parasitize the intrahepatic bile duct system, especially in the branching parts of the bile ducts, and occasionally in the pancreatic ducts. The adult worm has a narrow, flattened body, a thin tip at the front end, and a blunt and rounded posterior end, resembling a sunflower seed kernel, and the surface of the body is spineless and brown translucent. Adult worms are (10 to 25) mm in size× (3 to 5) mm, have two suction cups in the mouth and abdomen, and have the mouth, pharynx, esophagus, and branched intestinal tubes in the digestive organs. The reproductive organs are hermaphrodites, and both of their testicles are branched and arranged anteriorly and posteriorly at the rear end of the insect. Adult worms are slow to peristalsis and are mostly adsorbed on the mucous membrane of the inner wall of the bile ducts.

Its eggs are the smallest of the human parasitic eggs, about (27 to 35) μm× (12 to 20) μm, oval, with shoulders, bulb-like, thick shell, and mature hairy crickets inside. It is yellowish brown with an egg cap at the upper end and a small protrusion at the lower end.

Adult worms parasitize in the liver bile ducts of cats, dogs and humans, etc., the eggs are produced with the bile to the intestine, and are excreted with feces, the eggs fall into ponds and ditches, and are swallowed by the first intermediate host freshwater snail (snail, red bean snail, long horn snail, etc.), the hairy lice in the egg is hatched in the snail intestine, the hairy worm enters the lymphatic system and liver of the snail, and develops into a cytokine, a thunderclap and a tail larvae. The tail cymbal leaves the snail and escapes into the water, burrowing into the second intermediate host freshwater fish and freshwater shrimp, forming cysticers. People, cats, dogs, etc. are infected by swallowing raw or half-raw fish and shrimp containing cysticers. The cysticer shell can be digested by stomach acid and trypsin, and the larvae escape from the duodenum. The larvae retrograde along the bile ducts until the liver parasitizes in the bile ducts and eventually develops into adults in the bile ducts. It takes about 1 month from infection with cysticers to adults to mature ovulation, the entire life history from eggs to adults under suitable conditions takes about 3 months, and adults can survive for more than 3 years and 6 months in dogs, and can live for more than 20 years in humans.

2 Epidemiological features

The disease is mainly distributed in East Asian countries such as Japan, Korea and China. In China, with the exception of Qinghai, Tibet, Gansu, Inner Mongolia, Xinjiang and Ningxia, there are onset and epidemics in the remaining provinces. Guangdong is the province with the highest incidence in China, and the Sanjiang Plain in the northeast region of China is also a high incidence area of Chinese mycosomiasis, and the infection rate of Chinese mycodchiasis is high from April to May every year.

The epidemic of the disease is closely related to the number of sources of infection, the distribution of rivers and ponds, the pollution of water sources by feces, the distribution and breeding of the first and second intermediate hosts and the eating habits of local residents, as well as the feeding and management of cats, dogs and pigs.

Cats and dogs are mostly infected by eating raw fish, and pigs are infected by free range and eating feed such as raw fish and offal. People are often infected by eating raw or undercooked fish and shrimp, such as eating raw or undercooked fillets and drunken shrimp, undercooked hot pot or barbecue food, etc. Thoroughly cooking food is the most effective way to prevent parasitic diseases in humans.

In addition to dietary transmission of parasites, the oral fecal route is another important route of transmission. In areas where the disease is endemic, fecal contamination of water sources is an important factor contributing to the high rate of freshwater snail infection. In the southern region, toilets were built on fish ponds or pig houses on ponds, and the eggs of the disease entered the pond with human and animal feces, infecting snails and fish, and promoting the epidemic of the disease. Toilet construction away from ponds, human and animal manure after treatment and then discharge, strict adherence to good personal hygiene habits and improve bad living habits, help to prevent the infection and spread of Trebutydismus sinensis.

3 Hazards

After people eat fish and shrimp infected with Chinese mycosomiasis, the pathogenicity of Floral testicles is not strong, and when there are few parasites in the human body, mild infection does not show symptoms, or only gastrointestinal discomfort symptoms appear. Severe infection only appears obvious symptoms, can appear dyspepsia, epigastric pain, diarrhea, lack of energy, the main harm is the patient's liver damage, hepatomegaly, liver pain, due to the patient's long-term worm, the insect's metabolic secretion products and the mechanical stimulation of the insect body itself caused chronic damage to the hepatobiliary system, causing cholangitis, gallstones, obstructive jaundice, pancreatitis, and even cause hepatobiliary duct tumors, etc., serious infection in the late stage can cause liver cirrhosis, ascites and other clinical manifestations, and even death.

After childhood and adolescent infection with Clonorchidis sinensis, the clinical manifestations are often more severe and the case fatality rate is higher. In addition to gastrointestinal symptoms, malnutrition, growth and development disorders, anemia, hypoproteinemia, edema, hepatomegaly, and even cirrhosis of the liver are common, and a very small number of patients can develop dwarfism.

According to the results of a worm survey conducted by the Ministry of Health from June 2001 to the end of 2004, the infection rate of Rosteris was 2.4% in the population, and the number of infected people reached more than 12 million. In recent years, the incidence of Chinese mycodysteriasis in China has shown a significant downward trend.

4 Domestic and foreign health requirements

Hygiene requirements and treatment: when the damage is minor, the damage part is removed, and the other parts are not restricted from leaving the factory (field); in the case of serious damage, the entire organ is made or destroyed.

5 Detection methods

Diagnosis can be based on epidemiology, clinical manifestations, laboratory tests, etc. The clinical manifestations of Trebudiclessis are sometimes not typical, and attention should be paid to distinguishing them from hepatitis, acute and chronic cholecystitis, gastric and duodenal ulcer disease. Pay attention to the history of the disease to find out whether the patient has lived in an endemic area and whether there is a history of eating unfamiliar fish or raw freshwater fish and shrimp. The early symptoms of Floral testosteriasis are not obvious, and are generally mainly symptoms of the digestive system, with autonomic nerve symptoms. Physical examination found that there are different degrees of liver enlargement, often with left lobe enlargement is more obvious, blood routine detection of eosinophil proportion increases, should be further pathogenic examination and specific immunological diagnosis.

5.1 Etiological examination

Finding Oforchia warfarin fob eggs in feces or duodenal fluid through etiological examination is the basis for the diagnosis of the disease. Finding Chinese mycardibacteria eggs from feces is the most important evidence for confirming the diagnosis, and there are many examination methods, mainly two categories: smear method and egg collection method.

5.1.1 Direct smear method

Although the direct smear method is simple to operate, due to the small amount of feces used, the detection rate is not high, and it is easy to miss diagnosis. Direct smear of feces: the eggs are the smallest of the human parasitic eggs, about 30 μm× 14 μm, slightly like a light bulb, the shell is thick, brownish yellow, there is a small lid at the upper end, a small nodule at the lower end, and a mature caterpillar inside the egg.

Modified Kato's thick film smear (Kato-Katz glycerol paper thick smear transparent method) is considered an effective stool examination method in large-scale intestinal parasite investigations. Can be used for qualitative and quantitative examination of worm eggs. It is used for Testosome Warfarinida egg examination, and the detection rate can reach more than 95%.

5.1.2 Egg set method

The detection rate of the egg collection method is higher than that of direct smear, and the egg collection method includes two types: floating egg collection method and sedimentation egg collection method. Precipitate eggs are commonly used by water-washed centrifugal precipitation method and ether precipitation method, and then smear observation is carried out after precipitation. The floating egg collection method is commonly used after the saline floating method and the relative density of 1.23 zinc sulfate solution floating egg collection, and then smear observation. In general, the floating method is less effective than the precipitation method.

5.1.3 Duodenal drainage bile examination

Centrifugal sedimentation with bile drained from the duodenum may also result in the seizure of eggs for the diagnosis.

5.2 Immunological methods

Commonly used methods are intradermal test, indirect erythrocyte agglutination test (IHAT), indirect fluorescent antibody test (IFAT), ELISA. ELISA detects specific antibodies in patients' serum, this method detects Chinese myristic fluke patients and is used for epidemiological investigation, with the advantages of simplicity, rapidity, high sensitivity and strong specificity, and the positive rate is more than 88.8%, which is an ideal immunological method at present.

5.2.1 Intradermal test

Adult antigens should be used for intradermal tests, and high dilution antigens should be used for skin tests. Usually, adult saline cold immersion is used as an antigen [dilution of 1:(15000~30000)] as an intradermal test, and the positive rate can be as high as 97.9%, and the positive compliance rate with feces is as high as 99.5%. This test is simple and easy to implement, has high specificity, has almost no cross-reactivity with other trematode diseases, and has the value of auxiliary diagnosis and initial screening.

5.2.2 Indirect erythrocyte agglutination test (IHAT)

It has the advantages of simple operation and fast judgment results, but its stability is not ideal. The methods of antigen preparation are basically the same, but the steps and conditions of antigen extraction, antigen concentration for sensitized red blood cells, and treatment of red blood cells are different, and the positive rate of detection is 68.4% to 98.7%, and the difference range is large.

5.2.3 Enzyme-linked immunosorbent assay (ELISA)

This method detects specific antibodies in the serum of Rochydis sinensis patients and is used for epidemiological investigation, which has the advantages of simplicity, rapidity, high sensitivity and strong specificity, and the positive rate is more than 88.8%, which is an ideal immune detection method at present.

The detection of specific circulating antigens in the serum of patients with this disease was significantly better than the method of detecting antibodies by double antibody sandwich ELISA method.

5.3 Molecular biology methods

The first is the establishment of PCR and its derivation technology, based on the rapid development of molecular biology detection methods based on gene sequences, this technology is mainly used for the diagnosis of human Mycodylistheasis, and the specificity and sensitivity of its methods are more than 70%.

In addition, lamp detection technology establishes an RT-PCR detection system based on the design and synthesis of specific primers and probes according to the 18S rRNA gene of Trebusteris. Upstream primers: 5'-GCATTTGTGGCGGTGTTA-3', downstream primers: 5'-AACCTCTGACTTTCGCTCCA-3', amplification product of about 111bp; probe: 5'-(FAM) AACTACAGAAAGCATTTGCCAAGGA(Eclipse)-3', into the reaction system a total of 40 cycles. At the same time as the real-time PCR detection of Chinese myrchis, the DNA of Toxoplasma gondii, Schistosomiasis Japanese, and Schindrichma Guangzhou was also amplified by PCR under the same reaction conditions with specific primers of Trebusces Sinica to determine whether there was a cross-reaction. The RT-PCR detection method has good specificity and high sensitivity, and is suitable for rapid detection and quantitative analysis of Testosteria warfarinum on-site. It is an emerging method of nucleic acid molecular biology to detect pathogens, which has the characteristics of fast, sensitive and convenient, and the sensitivity is 10 to 100 times that of PCR.