Editor: Brother Jin
Text: Brother Jin
preface
This study developed a novel method to efficiently generate mutant marmosets using AET and CRISPR/Cas9 systems. We recover embryos from the fallopian tubes of naturally mating female marmosets, inject Cas9/guide RNA, and transfer them into the donor's fallopian tubes. We applied this new method and successfully generated 6 marmosets carrying mutations in the fragile X mental retardation 1 (FMR1) gene using only 18 females, including 14 non-fertile females.
Autologous Embryo Transfer (AET) is an assisted reproductive technology used to transfer fertilized eggs from one individual's reproductive system to the reproductive system of the same individual, combined with CRISPR/Cas9 technology, which can achieve efficient gene editing.
First, the purpose of the experiment
Currently, most genetically engineered animal models of human disease are generated using mice that are easily genetically engineered. However, genetically engineered mice cannot replicate all the symptoms of human disease. Therefore, it is expected that genetic engineering studies will be carried out on the non-human primates that are most closely related to humans.
Among non-human primates, there are several reports of genome editing of the genus Macaca (such as rhesus macaques and bobtail monkeys) for generating animal models of disease: MECP2 knockout monkeys using transcriptional activator-like effector nucleases (TALENs)1, RAG1 and PPARG knockout monkeys2, BMAL1 knockout monkeys 3 and PKD1 knockout monkeys4, all using CRISPR/Cas9 technology.
Common marmosets (Callithrix jacchus) are non-human primate species suitable for the production of genetically modified animals because of their small size and high reproductive capacity. Through viral infection and genome editing, transgenic and knockout marmosets were successfully produced. The traditional method of producing mutant marmosets consists of the following steps:
(1) Oocyte collection from the ovaries of a group of female animals called donors,
(2) in vitro mature oocytes and in vitro fertilization with sperm from male animals,
(3) Microinjection of proteins from DNA, RNA, or genome editing methods (such as TALEN and CRISPR/Cas9 systems) into embryos and cultured in vitro for several days,
(4) Transfer the injected embryos into the uterus of another group of female animals called recipients. Traditional methods require longer in vitro cultures and a large number of donor and recipient animals.
In addition, because these methods require the females who give birth as recipients, it is difficult to use these methods in laboratories with a limited number of females.
Autologous embryo transfer (AET) is a routinely used method in assisted reproductive technology in humans, primarily for the treatment of infertility. However, the application of AET to laboratory animals is relatively limited, but has not yet been applied to non-human primates.
By combining the AAT method of the CRISPR/Cas9 system, mutant marmosets were efficiently generated. Prokaryotic stage embryos are collected from naturally mating females, and the genome-edited embryos are autologously transferred to the fallopian tubes of the females that provide the embryos, and unborn females are used as recipients. This AAT method can reduce the time to culture embryos in vitro to less than 30 minutes, thereby improving the development efficiency of injected embryos.
2. Experimental methods
2.1 Experimental subjects
Common marmosets (Callithrix jacchus) are purchased by CLEA Japan Inc. (Tokyo, Japan) and undergo a 12-hour light/dark cycle (lights on at 08:00 and lights off at 20:00) while maintaining a temperature of 28°C, with an ample supply of food and water. Experiments use animals between 2 and 8 years old. By measuring the concentration of progesterone ([P4]) in the blood, a competitive enzyme immunoassay (ST AIA-PACK PROGII; East Grass Company), which monitors the estrus cycle of animals. The study also adhered to the ARRIVE (Animal Research: Reporting on In Vivo Experiments) guidelines applicable to animals.
2.2 Verification of gRNA
We verified the efficiency of gRNAs encoding exons encoding 31 amino acid residues (equivalent to 36-66,97% homology of human FMRP proteins) (FMR1-T5; GAGGTGGGAATCTGACATCATGG）。 SpCas9/gRNA complexes were transfected into marmoset embryonic stem cells (CMES40 (AES0166), RIKEN BRC CELL BANK)14 using CRISPRMAX transfection reagent (Thermo Fisher Scientific, Waltham, MA). At four days after transfection, genomic DNA is extracted from the transfected cells. Using primers:
（1′-GGGGGTCACACTTAACCAAGAGTTGATGGC-5′，
3′-CTAGTGGGCAAAGAAACTTGAGGCAGGGAC-5′）
Perform PCR at the FMR1 site under the following PCR conditions: hold at 94 °C for 2 min, 30 cycles, dissolve at 98 °C for 10 sec, annealing and extension at 68 °C for 50 sec, and finally extension at 68 °C for 2 min. PCR products are digested using lysozyme from the Mutation Detection Kit (Takara Bio USA, Mountain View, CA) and separated in a 2% agarose gel.
2.3 Embryo collection, microinjection and transfer
For embryo collection, we used both produced (n=4) and unproduced (n=14) female marmosets. To reset the estrous cycle in female marmosets, the prostaglandin analogue Estrustno (Estrumate; MSD Animal Health (Day 0). On day 1, we confirmed that [P4] was less than 10 ng/ml. From day 6, female marmosets mate with mature male marmosets. From day 8 onwards, female marmosets are checked daily for sperm in their vaginas to confirm mating. After confirmation of mating, competitive enzyme immunoassays (ST AIA-PACK iE2 and ST AIA-PACK PROGII; Dongcao) monitors estradiol concentrations ([E2]) and [P4] in the blood daily. When [P4] increases relative to the previous day and [E2] decreases relative to the previous day, embryos are collected from the fallopian tubes with a slight modification of the method, previously reported15. The result of the hormone concentration is expressed as a mean ± SEM.
The fallopian tubes and ovaries are exposed by midline abdominal resection and placed in a 60 mm Petri dish. We inserted a 27-gauge wing needle into the narrow part of the fallopian tube and rinsed twice with OptiMEM medium (Thermo Fisher Scientific) containing 9.1 mg/ml hyaluronidase (MilliporeSigma, Munich, Germany), 91 units/ml heparin (Mochida, Tokyo, Japan), and 0.091% polyvinyl alcohol (MilliporeSigma). Embryos are cultured in Cleav medium (Origio, Marlove, Denmark) at a temperature of 38 °C with an oxygen concentration of 5% and a carbon dioxide concentration of 5%, except when microinjection.
For injection of marmoset embryos, we prepared SpCas9 protein (100 ng/μl; Takara Bio, Kusatsu, Japan)/crRNA (50 ng/μl; Integrated DNA Technologies (IDT), Tokyo, Japan) / tracrRNA (50 ng/μl; IDT) mixture and SpCas9 protein (100 ng/μl; Takara）/sgRNA（50 ng/μl； Fasmac, Atsugi, Japan) mixture. A mixture of SpCas9 protein and gRNA is injected into the cytoplasm of the collected embryo and injected using M2 medium (MilliporeSigma). The injected embryos are auto-transferred into the fallopian tubes that provide the embryos. The time to manipulate embryos in vitro is no more than 30 min. One month after embryo transfer, pregnancy is confirmed by ultrasound. The maintenance of pregnancy is monitored weekly by measuring [P4] in urine.
2.4 Western blot analysis
Fibroblasts were found in 20 mM Tris-HCl (pH 7.4), 1 mM EDTA, 1% NP-40, 150 mM NaCl, 0.5% subbile salt, 0.1% SDS, and protease inhibitors (cOmplete Mini, EDTA-free; Roche) in buffer. The whole brain is homogenized in a buffer containing 0.32 M sucrose, 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, and protease inhibitors. 10 μg of protein is separated by SDS-PAGE and transferred to the Immobilon-P membrane (Merk Millipore, Burlington, MA). Probes are performed on the membrane with rabbit anti-human FMRP C-terminal sequence antibody (Abcam, ab17722) or murine anti-β-actin antibody (Millipore Sigma, A2228), followed by anti-rabbit or anti-murine HRP-labeled secondary antibodies. Bound antibodies can be visualized using ECL Prime detection reagents (GE Healthcare, Chicago, IL, RPN2232). The blot was imaged using the ChemiDoc imaging system (Bio-Rad, Hercules, CA) or the ImageQuant LAS 4000 system (GE Healthcare).
Third, the experimental results
Since there are reports that marmoset embryos obtained through natural mating have better developmental potential than embryos obtained by in vitro fertilization, we plan to collect embryos from naturally mated female marmosets. We optimized the embryo collection protocol to maximize the acquisition of cleavage stage embryos suitable for genome editing to generate mutants.
Female marmosets are given prostaglandin F2α (PGF2α) analogues to reset the estrous cycle. On day 1, confirm that the progesterone concentration ([P4]) is less than 10 ng/ml. On day 6, female marmosets begin mating with mature male marmosets. After confirming that there are sperm in the vagina, we monitor the estradiol concentration ([E2]) and [P4] in the blood daily. At 11-13 days, when [P4] increases relative to the previous day and [E2] decreases relatively, embryos are collected from the fallopian tubes of 18 female marmosets ([E2] = 0.21 ± 0.06 ng/ml (n = 7), < detection limit (0.02 ng/ml; n = 11）； [P4] = 5.6 ± 1.0 ng/ml（n = 18））。 We collected 36 embryos from 18 naturally mated female marmosets. Of these, 29 (81%) embryos were in cleavage stage. The average number of cleavage stage embryos per animal was 1.5 (childbearing experience, n = 4) and 1.6 (non-productive experience, n = 14), indicating that female marmosets with no birth experience could serve as embryo donors.
Embryos recovered from the fallopian tubes of naturally mating female marmosets. (a) 36 embryos recovered from 18 naturally mated female marmosets. Of these, 29 (81%) were in the cleavage phase (P.N.). (b) One cleavage stage embryo obtained by rinsing the fallopian tubes of naturally mating female marmosets. Two pronuclei can be observed. The scale is 50 μm.
These results show that we have successfully collected a large number of cleavage stage embryos from naturally mated marmosets, and 81% of them are in the optimal stage of development, the cleavage stage. In addition, we found that female marmosets with proletarian experiences can also serve as embryo donors, providing more options for genome editing studies.
IV. Conclusion
We successfully generated 6 FMR1 mutant marmosets and found that 5 of them expressed undetectable FMRP protein at 8 days of age, in contrast to the apparently normal development of Fmr1 knockout mice. In most patients with fragile X syndrome, abnormal amplification of the triple repeat (CGG) of the 5' untranslated region of the FMR1 gene results in hypermethylation, thereby inhibiting transcription. On the other hand, deletion variants at the FMR1 locus are occasionally observed in patients.
Therefore, the neonatal death observed in FMR1 knockout marmosets observed in this study may be a phenotype specific to common marmosets. We plan to obtain FMR1 heterozygous mutant females by mating heterozygous mutant males (#286) and wild-type females, or ICSI using AETs. Female patients with fragile X syndrome carry heterozygous mutations and exhibit milder symptoms than male patients carrying hemizygotes. Thus, it is possible that female FMR1 mutant offspring will survive in the neonatal stage to analyze the effects of reduced FMRP on higher brain function associated with symptoms of fragile X syndrome.
Bibliography:
- Hammond, L.S., Macias, M.M., Tarleton, J.C. & Pai, G.S., Fragile X Syndrome and Deletions in FMR1: New Cases 430–434 (1997).
- Bernardet, M. & Crusio, W.E.Fmr1 KO, Mice as Possible Models for Autism Trait, 1164–1176 (2006).
- 3.Tomioka, I. et al. Transgenic monkey model of the polyglutamine diseases recapitulating progressive neurological symptoms. eNeuro 4, e0250-e1216 (2017).
- 4. Hagerman, R. J. et al. National Revision of Fragile X Syndrome (2017).